FASTA

È uno dei formati di sequenza più vecchi.

Le uniche specifiche sono sostanzialmente:

  • le righe 'header' cominciano col carattere '>'1
  • la sequenza è suddivisa in righe di uguale lunghezza (tradizionalmente 60)

Standard per l'estensione del file: nessuno.

Esempio:

>gi|142864|gb|M10040.1|BACDNAE B.subtilis dnaE gene encoding DNA primase, complete cds
GTACGACGGAGTGTTATAAGATGGGAAATCGGATACCAGATGAAATTGTGGATCAGGTGCAAAAGTCGGC
AGATATCGTTGAAGTCATAGGTGATTATGTTCAATTAAAGAAGCAAGGCCGAAACTACTTTGGACTCTGT
CCTTTTCATGGAGAAAGCACACCTTCGTTTTCCGTATCGCCCGACAAACAGATTTTTCATTGCTTTGGCT
GCGGAGCGGGCGGCAATGTTTTCTCTTTTTTAAGGCAGATGGAAGGCTATTCTTTTGCCGAGTCGGTTTC
TCACCTTGCTGACAAATACCAAATTGATTTTCCAGATGATATAACAGTCCATTCCGGAGCCCGGCCAGAG
TCTTCTGGAGAACAAAAAATGGCTGAGGCACATGAGCTCCTGAAGAAATTTTACCATCATTTGTTAATAA
ATACAAAAGAAGGTCAAGAGGCACTGGATTATCTGCTTTCTAGGGGCTTTACGAAAGAGCTGATTAATGA
ATTTCAGATTGGCTATGCTCTTGATTCTTGGGACTTTATCACGAAATTCCTTGTAAAGAGGGGATTTAGT
GAGGCGCAAATGGAAAAAGCGGGTCTCCTGATCAGACGCGAAGACGGAAGCGGATATTTCGACCGCTTCA
GAAACCGTGTCATGTTTCCGATCCATGATCATCACGGGGCTGTTGTTGCTTTCTCAGGCAGGGCTCTTGG

Fonte: http://bioperl.org/wiki/FASTA_sequence_format

Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License